| deseq_fc_ecdf {SeedMatchR} | R Documentation | 
Plot the ECDF for DESeq2 log2(Fold Changes)
Description
This functions will take DESeq2 results as a data.frame and
plot the ecdf for the input gene.lists.
The gene sets to plot should be provided as a list of lists.
Example:
gene.lists = list("Background" = c("gene1", "gene2"), "Target" = c("gene2", "gene3"), "Overlap" = c("gene2"))
This function will also perform statistical testing if plot.hist is TRUE.
The output will be saved to a PDF if an output.filename is provided.
Users can define the groups that are to be compared in the statistical test
using the null.name and target.name arguments. The names must be found
in gene.lists. The factor.order is used to order the groups in the
analysis.
This functions returns:
-  
$plot: The ECDF plot -  
$stats: The stats results object 
Usage
deseq_fc_ecdf(
  res,
  gene.lists,
  title = "ECDF",
  output.filename = NULL,
  palette = SeedMatchR.palette,
  factor.order = NULL,
  x.lims = c(-1, 1),
  stats.test = NULL,
  alternative = "greater",
  null.name = 1,
  target.name = 2,
  height = 5,
  width = 5,
  dpi = 320
)
Arguments
res | 
 The DESeq2 results dataframe  | 
gene.lists | 
 A nest list of gene names. Example: gene.lists = list("Background" = gene.list2, "Target" = gene.list1, "Overlap" = gene.list3)  | 
title | 
 The tile of the plot  | 
output.filename | 
 If the output filename is provided, then the plot is saved.  | 
palette | 
 The color palette to use for your curves  | 
factor.order | 
 The order to use for the legends  | 
x.lims | 
 The xlimits range  | 
stats.test | 
 The statistic test to use. Options: KS, Kuiper, DTS, CVM, AD, Wass  | 
alternative | 
 The alternative hypothesis to test. Options: greater, less, two.sided  | 
null.name | 
 The name in the gene.list to use as the null for ecdf plots  | 
target.name | 
 The name in the gene.list to use as the target for ecdf plots  | 
height | 
 Plot height in inches  | 
width | 
 Plot width in inches  | 
dpi | 
 The dpi resolution for the figure  | 
Value
A ggplot object for the ECDF plot
Examples
library(dplyr)
guide.seq = "UUAUAGAGCAAGAACACUGUUUU"
anno.db = load_species_anno_db("human")
features = get_feature_seqs(anno.db$tx.db, anno.db$dna)
# Load test data
get_example_data("sirna")
sirna.data = load_example_data("sirna")
res <- sirna.data$Schlegel_2022_Ttr_D1_30mkg
# Filter DESeq2 results for SeedMatchR
res = filter_deseq(res, fdr.cutoff=1, fc.cutoff=0, rm.na.log2fc = TRUE)
res = SeedMatchR(res, anno.db$gtf, features$seqs, guide.seq, "mer7m8")
# Gene set 1
mer7m8.list = res$gene_id[res$mer7m8 >= 1]
# Gene set 2
background.list = res$gene_id[!(res$mer7m8 %in% mer7m8.list)]
ecdf.results = deseq_fc_ecdf(res,
list("Background" = background.list, "mer7m8" = mer7m8.list),
stats.test = "KS",
factor.order = c("Background", "mer7m8"),
null.name = "Background",
target.name = "mer7m8")