| stri_trans_char {stringi} | R Documentation |
Translate Characters
Description
Translates Unicode code points in each input string.
Usage
stri_trans_char(str, pattern, replacement)
Arguments
str |
character vector |
pattern |
a single character string providing code points to be translated |
replacement |
a single character string giving translated code points |
Details
Vectorized over str and with respect to each code point
in pattern and replacement.
If pattern and replacement consist of a different number
of code points, then the extra code points in the longer of the two
are ignored, with a warning.
If code points in a given pattern are not unique, the
last corresponding replacement code point is used.
Time complexity for each string in str is
O(stri_length(str)*stri_length(pattern)).
Value
Returns a character vector.
Author(s)
Marek Gagolewski and other contributors
See Also
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, doi:10.18637/jss.v103.i02
Other transform:
stri_trans_general(),
stri_trans_list(),
stri_trans_nfc(),
stri_trans_tolower()
Examples
stri_trans_char('id.123', '.', '_')
stri_trans_char('babaab', 'ab', '01')
stri_trans_char('GCUACGGAGCUUCGGAGCUAG', 'ACGT', 'TGCA')