| splitseq {seqinr} | R Documentation |
split a sequence into sub-sequences
Description
Split a sequence into sub-sequences of 3 (the default size) with no overlap between the sub-sequences.
Usage
splitseq(seq, frame = 0, word = 3)
Arguments
seq |
a vector of chars |
frame |
an integer (0, 1, 2) giving the starting position to split the sequence |
word |
an integer giving the size of the sub-sequences |
Value
This function returns a vector which contains the sub-sequences.
Author(s)
J.R. Lobry
References
citation("seqinr")
See Also
Examples
cds <- s2c("aacgttgcaggtcgctcgctacgtagctactgttt")
#
# To obtain the codon sequence in frame 0:
#
stopifnot(identical(splitseq(cds),
c("aac", "gtt", "gca", "ggt", "cgc", "tcg", "cta", "cgt", "agc", "tac", "tgt")))
#
# Show the effect of frame and word with a ten char sequence:
#
(tenchar <- s2c("1234567890"))
splitseq(tenchar, frame = 0)
splitseq(tenchar, frame = 1)
splitseq(tenchar, frame = 2)
splitseq(tenchar, frame = 0, word = 2)
splitseq(tenchar, frame = 0, word = 1)
[Package seqinr version 4.2-36 Index]