hdnaO {gquad} | R Documentation |
Predicting intramolecular triplexes (H-DNA) including overlaps
Description
This function predicts H-DNA in 'x' DNA sequence like the hdna function, but includes overlaps. DNA sequence can be provided in raw or fasta format or as GenBank accession number(s). Internet is needed to connect to GenBank database, if accession number(s) is given as argument.
Usage
hdnaO(x, xformat = "default")
Arguments
x |
DNA sequence(s) in raw format or a fasta file or a GenBank accession number(s); from which H-DNA (including overlaps) will be predicted. If the fasta file name does not contain an absolute path, the file name is relative to the current working directory. |
xformat |
a character string specifying the format of x : default (raw), fasta, GenBank (GenBank accession number(s)). |
Details
This function predicts H-DNA in DNA sequences, including overlaps and provide the position, sequence and length of the predicted motif(s), if any.
Value
A dataframe of H-DNA' position, sequence and length. If more than one DNA sequence is provided as argument, an input ID is returned for motif(s) predicted from each input sequence.
Author(s)
Hannah O. Ajoge
References
Paper on gquad and the web application (Non-B DNA Predictor) is under review, see draft in vignettes
See Also
hdna
Examples
## Predicting H-DNA (including overlaps) from raw DNA sequences
E1 <- c("TCTTCCCCCCTTTTTYYYYYGCTYYYYYTTTTTCCCCCCGAAT", "taggtgctgggaggtagagacaggatatcct")
hdnaO(E1)
## Predicting H-DNA (including overlaps) from DNA sequences in fasta file
## Not run: hdnaO(x="Example.fasta", xformat = "fasta")
## Predicting H-DNA (including overlaps) from DNA sequences,
## using GenBank accession numbers.
## Internet connectivity is needed for this to work.
## Not run: hdnaO(c("BH114913", "AY611035"), xformat = "GenBank")