P2_miRNA_rpm {ExpGenetic} | R Documentation |
RPM table of miRNAs in P2 (P2: one of the parents).
Description
RPM table of miRNAs in P2 species. The "P2" represents one of parents.
Examples
head(P2_miRNA_rpm)
# sequence Bnapus.1 Bnapus.2 Bnapus.3
#1 TTTGGATTGAAGGGAGCTCTA 1804.35 1362.88 1439.22
#2 TTAGATTCACGCACAAACTCG 59.60 64.35 61.42
#3 TGAAGCTGCCAGCATGATCTA 190.54 161.82 146.95
#4 CTTTGTCTATCGTTTGGAAAAG 148.04 147.29 150.32
#5 GATCATGTTCGCAGTTTCACC 82.46 73.25 88.36
#6 TTTCCAAATGTAGACAAAGCA 704.74 441.07 555.35
[Package ExpGenetic version 0.1.0 Index]