P1_miRNA_rpm {ExpGenetic} | R Documentation |
RPM table of miRNAs in P1 (P1: one of the parents).
Description
RPM table of miRNAs in P1 species. The "P1" represents one of parents.
Examples
head(P1_miRNA_rpm)
# sequence Brapa.1 Brapa.2 Brapa.3
#1 TTTGGATTGAAGGGAGCTCTA 1641.18 1116.03 1014.37
#2 TGAAGCTGCCAGCATGATCTA 129.33 103.23 103.68
#3 TTTCCAAATGTAGACAAAGCA 905.23 920.57 1180.51
#4 TCGGACCAGGCTTCATCCCCC 24.71 14.38 15.03
#5 AGAATCTTGATGATGCTGCAG 48.64 41.09 41.60
#6 TTGACAGAAGAAAGAGAGCAC 86.96 81.23 67.41
[Package ExpGenetic version 0.1.0 Index]