| P1_miRNA_count {ExpGenetic} | R Documentation |
Count table of miRNAs in P1 (P1: one of the parents).
Description
Count table of miRNAs in P1 species. The "P1" represents one of parents.
Examples
head(P1_miRNA_count)
# sequence Bnapus.1 Bnapus.2 Bnapus.3
#1 TTTGGATTGAAGGGAGCTCTA 29848 12094 10685
#2 TTAGATTCACGCACAAACTCG 986 571 456
#3 TGAAGCTGCCAGCATGATCTA 3152 1436 1091
#4 CTTTGTCTATCGTTTGGAAAAG 2449 1307 1116
#5 GATCATGTTCGCAGTTTCACC 1364 650 656
#6 TTTCCAAATGTAGACAAAGCA 11658 3914 4123
[Package ExpGenetic version 0.1.0 Index]